ybxG [2019-02-06 09:50:50]

similar to amino acid permease, putative threonine transporter

Locus: BSU02060

Isoelectric point: 9.60

Molecular weight: 49.94 kDa

Protein length: 462 aa

Gene length: 1389 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: ybdP

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Amino acid transporters → APC superfamily
• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of lysine/ threonine
• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of serine/ glycine/ alanine
• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of threonine/ glycine
• Groups of genes → Membrane proteins

Gene

Coordinates: 226,566 227,954

Phenotypes of a mutant

• a bcaP ybxG mutant confers resistance to 4-hydroxythreonine PubMed

The protein

Protein family

• amino acid-polyamine-organocation (APC) superfamily (according to UniProt)

Paralogous protein(s)

• RocC, RocE, YbgF, YdgF, AapA, GabP, YtnA, HutM, YvbW

Structure

• 5OQT (from Geobacillus kaustophilus, 23% identity) PubMed

Localization

• cell membrane (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: ybxG
  Description: PubMed

Biological materials

Mutant

• GP2396 ∆ybxG ::cat available in Jörg Stülke's lab
• BKE02060 (ybxG::erm), available in the BGSC and in Fabian Commichau's and Jörg Stülke's labs) PubMed
• BKE02060 (ybxG::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTCCTCTTCCTCCTCCTA, downstream forward: _UP4_TAACGATAAAAAAGAGACAT
• BKK02060 (ybxG::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTCCTCTTCCTCCTCCTA, downstream forward: _UP4_TAACGATAAAAAAGAGACAT

References

Loading